14-200x200

Input Ready (v2) run 29 Apr 2015 13:46:22 UTC


Name:

Workflow: Input Ready

Category: Phylogenetics

Status: Finished

Created at: 29 Apr 2015 14:08:45 UTC

Started at: 29 Apr 2015 14:08:46 UTC

Finished at: 29 Apr 2015 14:09:13 UTC

Outputs

Results (8)

DetailsPPtest help (application/x-error)

This output is an error, details are below.

Processor 'MrBayesPPtest' - Port 'PPtestDetails'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'TargetOnly' - Port 'out1'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)


ErrorDocument 2
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)


ErrorDocument 3
Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)



Geoks help (application/x-error)

This output is an error, details are below.

Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Pvalue'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)


GeoKSDetails help (application/x-error)

This output is an error, details are below.

Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'NiceXML'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)


MrBayesOutput help (application/x-error)

This output is an error, details are below.

Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)

newickTree help (application/x-error)

This output is an error, details are below.

Processor 'ConsensusTree' - Port 'Trees'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)


ErrorDocument 2
Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)



PhyloInferenceOutput help (application/x-error)

This output is an error, details are below.

Processor 'ConsensusTree' - Port 'ResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)


ErrorDocument 2
Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)



Plot help (application/x-error)

This output is an error, details are below.

Processor 'MrBayesPPtest' - Port 'Plot'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'TargetOnly' - Port 'out1'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)


ErrorDocument 2
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)


ErrorDocument 3
Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayes' - Port 'PathOfResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus

begin_data;
dimensions__ntax=15_nchar=567;
format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
matrix

ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end;_
begin_mrbayes;
set_autoclose=yes;
charset_Partition_1_=_1-299_;
charset_Partition_2_=_300-400_;
charset_Partition_3_=_401-567_;
partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
set_partition_=_current_partition;
Lset_applyto=(1)_rates=propinv_nst=2__;
Lset_applyto=(2)_rates=propinv_nst=2__;
Lset_applyto=(3)_rates=propinv_nst=2__;
unlink_topology=(all);
unlink_shape=(all);
unlink_Brlens=(all);
unlink_statefreq=(all);
link_tratio=(2,_3);
link_topology=(2,_3);
link_Brlens=(2,_3);
prset_applyto=(2,_3)_ratepr=variable;
mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;

mcmc;
quit;
end;


java.net.URI.create(unknown file)
org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
java.lang.Thread.run(unknown file)



ViewTree help ((list of depth 1))

  1. (application/x-error)

    This output is an error, details are below.

    Processor 'TreeVisualizationItol' - Port 'html'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'ConsensusTree' - Port 'Trees'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'MrBayes' - Port 'PathOfResultsFolder'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
    java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus
    
    begin_data;
    dimensions__ntax=15_nchar=567;
    format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
    matrix
    
    ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT
    
    ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT
    
    AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT
    
    AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT
    
    ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT
    
    ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT
    
    AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT
    
    AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT
    
    ;
    end;_
    begin_mrbayes;
    set_autoclose=yes;
    charset_Partition_1_=_1-299_;
    charset_Partition_2_=_300-400_;
    charset_Partition_3_=_401-567_;
    partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
    set_partition_=_current_partition;
    Lset_applyto=(1)_rates=propinv_nst=2__;
    Lset_applyto=(2)_rates=propinv_nst=2__;
    Lset_applyto=(3)_rates=propinv_nst=2__;
    unlink_topology=(all);
    unlink_shape=(all);
    unlink_Brlens=(all);
    unlink_statefreq=(all);
    link_tratio=(2,_3);
    link_topology=(2,_3);
    link_Brlens=(2,_3);
    prset_applyto=(2,_3)_ratepr=variable;
    mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;
    
    mcmc;
    quit;
    end;
    
    
    java.net.URI.create(unknown file)
    org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
    net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
    java.lang.Thread.run(unknown file)
    
    
    ErrorDocument 2
    Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'MrBayes' - Port 'PathOfResultsFolder'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
    java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus
    
    begin_data;
    dimensions__ntax=15_nchar=567;
    format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
    matrix
    
    ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT
    
    ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT
    
    AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT
    
    AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT
    
    ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT
    
    ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT
    
    AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT
    
    AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT
    
    ;
    end;_
    begin_mrbayes;
    set_autoclose=yes;
    charset_Partition_1_=_1-299_;
    charset_Partition_2_=_300-400_;
    charset_Partition_3_=_401-567_;
    partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
    set_partition_=_current_partition;
    Lset_applyto=(1)_rates=propinv_nst=2__;
    Lset_applyto=(2)_rates=propinv_nst=2__;
    Lset_applyto=(3)_rates=propinv_nst=2__;
    unlink_topology=(all);
    unlink_shape=(all);
    unlink_Brlens=(all);
    unlink_statefreq=(all);
    link_tratio=(2,_3);
    link_topology=(2,_3);
    link_Brlens=(2,_3);
    prset_applyto=(2,_3)_ratepr=variable;
    mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;
    
    mcmc;
    quit;
    end;
    
    
    java.net.URI.create(unknown file)
    org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
    net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
    java.lang.Thread.run(unknown file)
    
    
    
    
    

Errors/Logs (1)

Log ((list of depth 1))

  1. (application/x-error)

    This output is an error, details are below.

    Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Log'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'MrBayes' - Port 'PathOfResultsFolder'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
    java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus
    
    begin_data;
    dimensions__ntax=15_nchar=567;
    format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
    matrix
    
    ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT
    
    ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT
    
    AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT
    
    AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT
    
    ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT
    
    ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT
    
    AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT
    
    AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT
    
    ;
    end;_
    begin_mrbayes;
    set_autoclose=yes;
    charset_Partition_1_=_1-299_;
    charset_Partition_2_=_300-400_;
    charset_Partition_3_=_401-567_;
    partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
    set_partition_=_current_partition;
    Lset_applyto=(1)_rates=propinv_nst=2__;
    Lset_applyto=(2)_rates=propinv_nst=2__;
    Lset_applyto=(3)_rates=propinv_nst=2__;
    unlink_topology=(all);
    unlink_shape=(all);
    unlink_Brlens=(all);
    unlink_statefreq=(all);
    link_tratio=(2,_3);
    link_topology=(2,_3);
    link_Brlens=(2,_3);
    prset_applyto=(2,_3)_ratepr=variable;
    mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;
    
    mcmc;
    quit;
    end;
    
    
    java.net.URI.create(unknown file)
    org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
    net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
    java.lang.Thread.run(unknown file)
    
    
    

  2. (application/x-error)

    This output is an error, details are below.

    Processor 'ConsensusTree' - Port 'Log'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'MrBayes' - Port 'PathOfResultsFolder'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
    java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus
    
    begin_data;
    dimensions__ntax=15_nchar=567;
    format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
    matrix
    
    ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT
    
    ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT
    
    AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT
    
    AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT
    
    ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT
    
    ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT
    
    AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT
    
    AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT
    
    ;
    end;_
    begin_mrbayes;
    set_autoclose=yes;
    charset_Partition_1_=_1-299_;
    charset_Partition_2_=_300-400_;
    charset_Partition_3_=_401-567_;
    partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
    set_partition_=_current_partition;
    Lset_applyto=(1)_rates=propinv_nst=2__;
    Lset_applyto=(2)_rates=propinv_nst=2__;
    Lset_applyto=(3)_rates=propinv_nst=2__;
    unlink_topology=(all);
    unlink_shape=(all);
    unlink_Brlens=(all);
    unlink_statefreq=(all);
    link_tratio=(2,_3);
    link_topology=(2,_3);
    link_Brlens=(2,_3);
    prset_applyto=(2,_3)_ratepr=variable;
    mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;
    
    mcmc;
    quit;
    end;
    
    
    java.net.URI.create(unknown file)
    org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
    net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
    java.lang.Thread.run(unknown file)
    
    
    ErrorDocument 2
    Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'MrBayes' - Port 'PathOfResultsFolder'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
    java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus
    
    begin_data;
    dimensions__ntax=15_nchar=567;
    format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
    matrix
    
    ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT
    
    ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT
    
    AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT
    
    AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT
    
    ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT
    
    ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT
    
    AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT
    
    AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT
    
    ;
    end;_
    begin_mrbayes;
    set_autoclose=yes;
    charset_Partition_1_=_1-299_;
    charset_Partition_2_=_300-400_;
    charset_Partition_3_=_401-567_;
    partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
    set_partition_=_current_partition;
    Lset_applyto=(1)_rates=propinv_nst=2__;
    Lset_applyto=(2)_rates=propinv_nst=2__;
    Lset_applyto=(3)_rates=propinv_nst=2__;
    unlink_topology=(all);
    unlink_shape=(all);
    unlink_Brlens=(all);
    unlink_statefreq=(all);
    link_tratio=(2,_3);
    link_topology=(2,_3);
    link_Brlens=(2,_3);
    prset_applyto=(2,_3)_ratepr=variable;
    mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;
    
    mcmc;
    quit;
    end;
    
    
    java.net.URI.create(unknown file)
    org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
    net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
    java.lang.Thread.run(unknown file)
    
    
    
    

  3. (application/x-error)

    This output is an error, details are below.

    Processor 'MrBayes' - Port 'Log'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'REST_Service' - Port 'redirection': Uncaught exception while invoking net.sf.taverna.t2.activities.rest.RESTActivity@370a646b
    java.lang.IllegalArgumentException: Illegal character in fragment at index 53: http://testjst.ba.infn.it/openacces/1349780982/#Nexus
    
    begin_data;
    dimensions__ntax=15_nchar=567;
    format_datatype=dna_interleave=no_gap=-_missing=?_Matchchar=.;
    matrix
    
    ABY27676_1_453__code2_frame0__---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT
    
    ADW61587_1_657__code5_frame0__TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT
    
    AEE92862_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    AEC60810_1_657__code5_frame0__TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT
    
    AEE92861_1_633__code5_frame0__---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    AEE92860_1_648__code5_frame0__------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADD09384_1_555__code1_frame0__------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT
    
    ADJ82639_1_645__code5_frame0__TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT
    
    ADQ21240_1_648__code5_frame0__TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT
    
    AEE92882_1_657__code5_frame0__TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT
    
    ADW58691_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ADW58631_1_657__code5_frame0__TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT
    
    ACM89220_1_657__code5_frame0__TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT
    
    AEE92867_1_642__code5_frame0__---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT
    
    ADH12119_1_645__code5_frame0__TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT
    
    ;
    end;_
    begin_mrbayes;
    set_autoclose=yes;
    charset_Partition_1_=_1-299_;
    charset_Partition_2_=_300-400_;
    charset_Partition_3_=_401-567_;
    partition_current_partition_=3:_Partition_1,_Partition_2,_Partition_3;
    set_partition_=_current_partition;
    Lset_applyto=(1)_rates=propinv_nst=2__;
    Lset_applyto=(2)_rates=propinv_nst=2__;
    Lset_applyto=(3)_rates=propinv_nst=2__;
    unlink_topology=(all);
    unlink_shape=(all);
    unlink_Brlens=(all);
    unlink_statefreq=(all);
    link_tratio=(2,_3);
    link_topology=(2,_3);
    link_Brlens=(2,_3);
    prset_applyto=(2,_3)_ratepr=variable;
    mcmcp_ngen=100000_samplefreq=100_nchains=4_temp=0.200000_nruns=2_;
    
    mcmc;
    quit;
    end;
    
    
    java.net.URI.create(unknown file)
    org.apache.http.client.methods.HttpPut.(HttpPut.java:68)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.doPUT(HTTPRequestHandler.java:192)
    net.sf.taverna.t2.activities.rest.HTTPRequestHandler.initiateHTTPRequest(HTTPRequestHandler.java:134)
    net.sf.taverna.t2.activities.rest.RESTActivity$1.run(RESTActivity.java:264)
    java.lang.Thread.run(unknown file)
    
    

Inputs

Data (1)

InputBody help (text/plain)

#Nexus

begin data;
dimensions  ntax=15 nchar=567;
format datatype=dna interleave=no gap=- missing=? Matchchar=.;
matrix

ABY27676_1_453__code2_frame0  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0  TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0  TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0  TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0  ---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0  ------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0  ------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0  TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0  TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0  TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0  TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0  TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0  TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0  ---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0  TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end; 
begin mrbayes;
set autoclose=yes;
charset Partition_1 = 1-299 ;
charset Partition_2 = 300-400 ;
charset Partition_3 = 401-567 ;
partition current_partition =3: Partition_1, Partition_2, Partition_3;
set partition = current_partition;
Lset applyto=(1) rates=propinv nst=2  ;
Lset applyto=(2) rates=propinv nst=2  ;
Lset applyto=(3) rates=propinv nst=2  ;
unlink topology=(all);
unlink shape=(all);
unlink Brlens=(all);
unlink statefreq=(all);
link tratio=(2, 3);
link topology=(2, 3);
link Brlens=(2, 3);
prset applyto=(2, 3) ratepr=variable;
mcmcp ngen=100000 samplefreq=100 nchains=4 temp=0.200000 nruns=2 ;
mcmc;
quit;
end;

Parameters (2)

File_name help (text/plain)

#Nexus

begin data;
dimensions  ntax=15 nchar=567;
format datatype=dna interleave=no gap=- missing=? Matchchar=.;
matrix

ABY27676_1_453__code2_frame0  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0  TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0  TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0  TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0  ---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0  ------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0  ------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0  TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0  TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0  TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0  TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0  TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0  TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0  ---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0  TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end; 
begin mrbayes;
set autoclose=yes;
charset Partition_1 = 1-299 ;
charset Partition_2 = 300-400 ;
charset Partition_3 = 401-567 ;
partition current_partition =3: Partition_1, Partition_2, Partition_3;
set partition = current_partition;
Lset applyto=(1) rates=propinv nst=2  ;
Lset applyto=(2) rates=propinv nst=2  ;
Lset applyto=(3) rates=propinv nst=2  ;
unlink topology=(all);
unlink shape=(all);
unlink Brlens=(all);
unlink statefreq=(all);
link tratio=(2, 3);
link topology=(2, 3);
link Brlens=(2, 3);
prset applyto=(2, 3) ratepr=variable;
mcmcp ngen=100000 samplefreq=100 nchains=4 temp=0.200000 nruns=2 ;

mcmc;
quit;
end;

SampleSize help (text/plain)

100

Advanced
Eu_logo
BioVeL has received funding from the European Union's Seventh Framework Programme for research, technological development and demonstration under grant agreement no. 283359.

Portal version: 1.6.1-61c993b