14-200x200

Input Ready (v2) run 29 Apr 2015 14:17:42 UTC


Name:

Workflow: Input Ready

Category: Phylogenetics

Status: Finished (Report submitted)

Created at: 29 Apr 2015 14:18:00 UTC

Started at: 29 Apr 2015 14:18:01 UTC

Finished at: 30 Apr 2015 02:16:29 UTC

Outputs

Results (8)

DetailsPPtest help (application/x-error)

This output is an error, details are below.

Processor 'MrBayesPPtest' - Port 'PPtestDetails'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 


ErrorDocument 2
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 

Geoks help (application/x-error)

This output is an error, details are below.

Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Pvalue'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 

GeoKSDetails help (application/x-error)

This output is an error, details are below.

Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'NiceXML'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 

MrBayesOutput help (application/x-error)

This output is an error, details are below.

Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 

newickTree help (application/x-error)

This output is an error, details are below.

Processor 'ConsensusTree' - Port 'Trees'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 


ErrorDocument 2
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 

PhyloInferenceOutput help (application/x-error)

This output is an error, details are below.

Processor 'ConsensusTree' - Port 'ResultsFolder'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 


ErrorDocument 2
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 

Plot help (application/x-error)

This output is an error, details are below.

Processor 'MrBayesPPtest' - Port 'Plot'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 


ErrorDocument 2
Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 

ViewTree help ((list of depth 1))

  1. (application/x-error)

    This output is an error, details are below.

    Processor 'TreeVisualizationItol' - Port 'html'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'ConsensusTree' - Port 'Trees'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 
    
    
    ErrorDocument 2
    Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 
    
    
    

Errors/Logs (1)

Log ((list of depth 1))

  1. (application/x-error)

    This output is an error, details are below.

    Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Log'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 
    
    

  2. (application/x-error)

    This output is an error, details are below.

    Processor 'ConsensusTree' - Port 'Log'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'ConVergenceTreeDiagnosticGeoKS' - Port 'Burnin'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 
    
    
    ErrorDocument 2
    Processor 'RetrivingJob' - Port 'Output': Can't invoke condition service 
    
    

  3. (application/x-error)

    This output is an error, details are below.

    Processor 'Merge_String_List_to_a_String' - Port 'concatenated'
    Set of ErrorDocuments to follow.
    ErrorDocument list 1
    Processor 'Logger_2' - Port 'output'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'Decodebase64tobyte_2' - Port 'out'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'RetrivingJob' - Port 'StandardError': Can't invoke condition service 
    
    
    
    

Inputs

Data (1)

InputBody help (text/plain)

#Nexus

begin data;
dimensions  ntax=15 nchar=567;
format datatype=dna interleave=no gap=- missing=? Matchchar=.;
matrix

ABY27676_1_453__code2_frame0  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0  TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0  TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0  TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0  ---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0  ------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0  ------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0  TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0  TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0  TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0  TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0  TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0  TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0  ---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0  TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end; 
begin mrbayes;
set autoclose=yes;
charset Partition_1 = 1-299 ;
charset Partition_2 = 300-400 ;
charset Partition_3 = 401-567 ;
partition current_partition =3: Partition_1, Partition_2, Partition_3;
set partition = current_partition;
Lset applyto=(1) rates=propinv nst=2  ;
Lset applyto=(2) rates=propinv nst=2  ;
Lset applyto=(3) rates=propinv nst=2  ;
unlink topology=(all);
unlink shape=(all);
unlink Brlens=(all);
unlink statefreq=(all);
link tratio=(2, 3);
link topology=(2, 3);
link Brlens=(2, 3);
prset applyto=(2, 3) ratepr=variable;
mcmcp ngen=100000 samplefreq=100 nchains=4 temp=0.200000 nruns=2 ;

mcmc;
quit;
end;

Parameters (2)

File_name help (text/plain)

pippo

SampleSize help (text/plain)

100

Advanced
Eu_logo
BioVeL has received funding from the European Union's Seventh Framework Programme for research, technological development and demonstration under grant agreement no. 283359.

Portal version: 1.6.1-61c993b