14-200x200

Bayesian Phylogenetic Inference: Select Model For Me - Submission (v2) run 22 Jun 2015 19:19:53 UTC


Name:

Workflow: Bayesian Phylogenetic Inference: Select Model For Me - Submission

Category: Phylogenetics

Status: Finished (Report submitted)

Created at: 22 Jun 2015 19:24:00 UTC

Started at: 22 Jun 2015 19:24:01 UTC

Finished at: 22 Jun 2015 19:24:20 UTC

Outputs

Results (3)

JobID help (application/x-error)

This output is an error, details are below.

Processor 'XPath_Service' - Port 'firstNode'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'REST_Service' - Port 'responseBody'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'JSTWebDav3Input' - Port 'REST_Service_redirection'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayesParser' - Port 'MrBayesBlock'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'fasta2phy' - Port 'MSAphy': Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.InvocationException: Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.local.LocalUseCaseInvocation.submit_wait_fetch_results(LocalUseCaseInvocation.java:390)
net.sf.taverna.t2.activities.externaltool.ExternalToolActivity$1.run(ExternalToolActivity.java:258)
java.lang.Thread.run(unknown file)

ErrorDocument 2
Processor 'Call_PartitionFinder' - Port 'Standardoutput'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'Concatenate_two_strings' - Port 'output'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'JSTWebDav3Input_2' - Port 'REST_Service_redirection'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'fasta2phy' - Port 'MSAphy': Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.InvocationException: Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.local.LocalUseCaseInvocation.submit_wait_fetch_results(LocalUseCaseInvocation.java:390)
net.sf.taverna.t2.activities.externaltool.ExternalToolActivity$1.run(ExternalToolActivity.java:258)
java.lang.Thread.run(unknown file)







NameFile (application/x-error)

This output is an error, details are below.

Processor 'TargetOnly' - Port 'out1'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'JSTWebDav3Input' - Port 'REST_Service_redirection'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'MrBayesParser' - Port 'MrBayesBlock'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'fasta2phy' - Port 'MSAphy': Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.InvocationException: Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.local.LocalUseCaseInvocation.submit_wait_fetch_results(LocalUseCaseInvocation.java:390)
net.sf.taverna.t2.activities.externaltool.ExternalToolActivity$1.run(ExternalToolActivity.java:258)
java.lang.Thread.run(unknown file)

ErrorDocument 2
Processor 'Call_PartitionFinder' - Port 'Standardoutput'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'Concatenate_two_strings' - Port 'output'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'JSTWebDav3Input_2' - Port 'REST_Service_redirection'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'fasta2phy' - Port 'MSAphy': Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.InvocationException: Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.local.LocalUseCaseInvocation.submit_wait_fetch_results(LocalUseCaseInvocation.java:390)
net.sf.taverna.t2.activities.externaltool.ExternalToolActivity$1.run(ExternalToolActivity.java:258)
java.lang.Thread.run(unknown file)






PartitionFinderDetails help (application/x-error)

This output is an error, details are below.

Processor 'Call_PartitionFinder' - Port 'Output_Path'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'Concatenate_two_strings' - Port 'output'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'JSTWebDav3Input_2' - Port 'REST_Service_redirection'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'fasta2phy' - Port 'MSAphy': Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.InvocationException: Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.local.LocalUseCaseInvocation.submit_wait_fetch_results(LocalUseCaseInvocation.java:390)
net.sf.taverna.t2.activities.externaltool.ExternalToolActivity$1.run(ExternalToolActivity.java:258)
java.lang.Thread.run(unknown file)



Errors/Logs (3)

Log ((list of depth 1))

  1. (application/x-error)

    This output is an error, details are below.

    Processor 'Merge_String_List_to_a_String' - Port 'concatenated'
    Set of ErrorDocuments to follow.
    ErrorDocument list 1
    Processor 'Logger' - Port 'output'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'Call_PartitionFinder' - Port 'StandardError'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'Concatenate_two_strings' - Port 'output'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'JSTWebDav3Input_2' - Port 'REST_Service_redirection'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'fasta2phy' - Port 'MSAphy': Invalid exit code 1:Traceback (most recent call last):
      File "Fasta2Phy.py", line 13, in 
        out=Fasta2Phy(sys.argv[1])
      File "Fasta2Phy.py", line 6, in Fasta2Phy
        nseq=len(records[0][1])
    IndexError: list index out of range
    
    de.uni_luebeck.inb.knowarc.usecases.invocation.InvocationException: Invalid exit code 1:Traceback (most recent call last):
      File "Fasta2Phy.py", line 13, in 
        out=Fasta2Phy(sys.argv[1])
      File "Fasta2Phy.py", line 6, in Fasta2Phy
        nseq=len(records[0][1])
    IndexError: list index out of range
    
    de.uni_luebeck.inb.knowarc.usecases.invocation.local.LocalUseCaseInvocation.submit_wait_fetch_results(LocalUseCaseInvocation.java:390)
    net.sf.taverna.t2.activities.externaltool.ExternalToolActivity$1.run(ExternalToolActivity.java:258)
    java.lang.Thread.run(unknown file)
    
    
    
    
    ErrorDocument 2
    Processor 'Call_PartitionFinder' - Port 'JobID'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'Concatenate_two_strings' - Port 'output'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'JSTWebDav3Input_2' - Port 'REST_Service_redirection'
    Set of ErrorDocuments to follow.
    ErrorDocument 1
    Processor 'fasta2phy' - Port 'MSAphy': Invalid exit code 1:Traceback (most recent call last):
      File "Fasta2Phy.py", line 13, in 
        out=Fasta2Phy(sys.argv[1])
      File "Fasta2Phy.py", line 6, in Fasta2Phy
        nseq=len(records[0][1])
    IndexError: list index out of range
    
    de.uni_luebeck.inb.knowarc.usecases.invocation.InvocationException: Invalid exit code 1:Traceback (most recent call last):
      File "Fasta2Phy.py", line 13, in 
        out=Fasta2Phy(sys.argv[1])
      File "Fasta2Phy.py", line 6, in Fasta2Phy
        nseq=len(records[0][1])
    IndexError: list index out of range
    
    de.uni_luebeck.inb.knowarc.usecases.invocation.local.LocalUseCaseInvocation.submit_wait_fetch_results(LocalUseCaseInvocation.java:390)
    net.sf.taverna.t2.activities.externaltool.ExternalToolActivity$1.run(ExternalToolActivity.java:258)
    java.lang.Thread.run(unknown file)
    
    
    
    
    
    

PartitionFinderOutput help (application/x-error)

This output is an error, details are below.

Processor 'Call_PartitionFinder' - Port 'Standardoutput'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'Concatenate_two_strings' - Port 'output'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'JSTWebDav3Input_2' - Port 'REST_Service_redirection'
Set of ErrorDocuments to follow.
ErrorDocument 1
Processor 'fasta2phy' - Port 'MSAphy': Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.InvocationException: Invalid exit code 1:Traceback (most recent call last):
  File "Fasta2Phy.py", line 13, in 
    out=Fasta2Phy(sys.argv[1])
  File "Fasta2Phy.py", line 6, in Fasta2Phy
    nseq=len(records[0][1])
IndexError: list index out of range

de.uni_luebeck.inb.knowarc.usecases.invocation.local.LocalUseCaseInvocation.submit_wait_fetch_results(LocalUseCaseInvocation.java:390)
net.sf.taverna.t2.activities.externaltool.ExternalToolActivity$1.run(ExternalToolActivity.java:258)
java.lang.Thread.run(unknown file)



SessionID (text/plain)

1709244327

Inputs

Data (2)

MSA_fasta help (text/plain)

#Nexus

begin data;
dimensions  ntax=15 nchar=567;
format datatype=dna interleave=no gap=- missing=? Matchchar=.;
matrix

ABY27676_1_453__code2_frame0  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTAATAATTTCTTCAATA---GTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTAGGTCATTCA---GGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTTGTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTATTAGCCTGGGGTATTACGATATTATTAACAGAT

ADW61587_1_657__code5_frame0  TTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATT---GGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTTATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGCGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTAATTATTTCTTCTATA---GTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCT---AGTTTAGAGGGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGGGCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTTGTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTTTGGCGGGGGCTATCACAATATTATTAACTGAT

AEE92862_1_657__code5_frame0  TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

AEC60810_1_657__code5_frame0  TTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGGTCAAGTTGGA---AGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTTATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGTGCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTATTATTATCTTCTTTA---GTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCC---TCTGGGGTTGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGGGCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTTGTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTATTGGCTGGTGCTATTACTATATTGTTGACTGAT

AEE92861_1_633__code5_frame0  ---------------------------GCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---ATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

AEE92860_1_648__code5_frame0  ------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADD09384_1_555__code1_frame0  ------------------------------------------------------------------------------------------------------CTATACAATGTATTAATTACCGCTCATGCTATAATTGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGTGCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTAATGCTGTCAGGTTTGGCT---GGTACTGGCTGGACACTGTATCCTCCTCTAAGT---AGTATAGTAGGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGTTCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTTGTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTTTAGGGGGTGCAATAACCATGTTACTGACTGAT

ADJ82639_1_645__code5_frame0  TTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATG---GGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTATCTATATCTTCTATA---GTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCG---TCTACAGTTGGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTTGTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTATTAGCAGGTGCTATTACTATATTATTAACAGAT

ADQ21240_1_648__code5_frame0  TTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGGACAAACTGGT---AGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGAGCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTGTTTATTTCAAGCATA---GTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCC---TCTTTAGAGGGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGGGCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTTTAGCTGGGGCTATCACAATATTACTGACGGAT

AEE92882_1_657__code5_frame0  TTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGG---AGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTATTGGCGGGGGCTATTACGATATTACTAACAGAT

ADW58691_1_657__code5_frame0  TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ADW58631_1_657__code5_frame0  TTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATA---GGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTTATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTATTTATTTCTTCTATA---GTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCA---TCTAGTGTAGGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTATTAGCAGGTGCTATTACTATATTATTAACTGAT

ACM89220_1_657__code5_frame0  TTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGGATTTTCTGGA---AGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATTATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTATTTATTTCTTCTATG---GTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCT---TCTTCTGTGGGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTTGTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTATTAGCTGGGGCTATTACTATACTTTTAACTGAT

AEE92867_1_642__code5_frame0  ---------------GGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGGGCAAGTGGGA---AGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTAATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGAGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTGGTGTTGTCTTCTTTA---GTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCT---TCGGGAGTTGGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTTGTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGTTGGCGGGGGCTATTACAATATTATTGACAGAT

ADH12119_1_645__code5_frame0  TTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGGGCAATCTGGT---AGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTATTTATTTCTTCTATG---GTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCG---TCTCTAGAAGGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTTGTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTTTAGCTGGGGCTATCACTATGTTATTAACTGAT

;
end; 
begin mrbayes;
set autoclose=yes;
charset Partition_1 = 1-299 ;
charset Partition_2 = 300-400 ;
charset Partition_3 = 401-567 ;
partition current_partition =3: Partition_1, Partition_2, Partition_3;
set partition = current_partition;
Lset applyto=(1) rates=propinv nst=2  ;
Lset applyto=(2) rates=propinv nst=2  ;
Lset applyto=(3) rates=propinv nst=2  ;
unlink topology=(all);
unlink shape=(all);
unlink Brlens=(all);
unlink statefreq=(all);
link tratio=(2, 3);
link topology=(2, 3);
link Brlens=(2, 3);
prset applyto=(2, 3) ratepr=variable;
mcmcp ngen=100000 samplefreq=100 nchains=4 temp=0.200000 nruns=2 ;

mcmc;
quit;
end;

Possible_Partition help (text/plain)

COI_pos1=1-657\3;
COI_pos2=2-657\3;
COI_pos3=3-657\3;

Parameters (7)

File_name help (text/plain)

pippo

Linking_branches help (text/plain)

linked

Number_of_MCMCMC_generations help (text/plain)

100000

Number_of_runs help (text/plain)

2

SampleSize help (text/plain)

100

Statistical_Criterium help (text/plain)

AIC

Advanced
Eu_logo
BioVeL has received funding from the European Union's Seventh Framework Programme for research, technological development and demonstration under grant agreement no. 283359.

Portal version: 1.6.1-61c993b