14-200x200

Select Model For Me with components (v4) run 26 Jun 2015 16:02:26 UTC


Name:

Workflow: Select Model For Me with components

Category: Phylogenetics

Status: Finished

Created at: 26 Jun 2015 16:02:35 UTC

Started at: 26 Jun 2015 16:02:36 UTC

Finished at: 26 Jun 2015 16:16:30 UTC

Outputs

Results (6)

Geoks help (text/plain)

0.698286

newickTree help ((list of depth 1))

  1. (text/plain)

    (ADD09384_1_555_ADD09384:1.79638,ABY27676_1_453_ABY27676:0.32495,(ACM89220_1_657_ACM89220:0.34688,(ADJ82639_1_645_ADJ82639:0.31063,(ADW58631_1_657_ADW58631:0.00684,ADW58691_1_657_ADW58691:0.00642)1.00:0.15091)1.00:0.14269,(ADW61587_1_657_ADW61587:0.18125,(ADH12119_1_645_ADH12119:0.28479,ADQ21240_1_648_ADQ21240:0.28166)0.93:0.12453)0.93:0.16722,(AEC60810_1_657_AEC60810:0.24994,((AEE92862_1_657_AEE92862:0.00233,AEE92882_1_657_AEE92882:0.00370)0.87:0.02374,(AEE92860_1_648_AEE92860:0.00232,AEE92861_1_633_AEE92861:0.00499,AEE92867_1_642_AEE92867:0.00378)0.92:0.02691)1.00:0.35630)0.93:0.26055)0.54:0.23888);

PartitionFinderOutput help (text/plain)

Best scheme according to Greedy algorithm, analysed with aic

Scheme Name    : 1
Scheme lnL     : -3580.51738
Scheme AIC     : 7267.03476
Scheme AICc    : 7276.52729731
Scheme BIC     : 7504.88201298
Num params     : 53
Num sites      : 657
Num subsets    : 3

Subset | Best Model | Subset Partitions              | Subset Sites                   | Alignment                               
1      | GTR+I+G    | Gene1_pos1                     | 1-657\3                        | ./analysis/phyml/50bf1643d2a386419c9264eccd173b6b.phy
2      | GTR+G      | Gene1_pos2                     | 2-657\3                        | ./analysis/phyml/70bf411485fb1fe3503bc4f094e24b4a.phy
3      | HKY+G      | Gene1_pos3                     | 3-657\3                        | ./analysis/phyml/2d8c90733ab81be78313d5cf934c6639.phy


Scheme Description in PartitionFinder format
Scheme_1 = (Gene1_pos1) (Gene1_pos2) (Gene1_pos3);

RaxML-style partition definitions
DNA, p1 = 1-657\3
DNA, p2 = 2-657\3
DNA, p3 = 3-657\3



Plot help ((list of depth 2))


    1. (image/png)

Errors/Logs (5)

GeoKSDetails help ((list of depth 1))

  1. (text/plain)

    Success of Convergence:True

  2. (text/plain)

    value of burnin:19

  3. (text/plain)

    P value or Probability that chains converged:0.698286

  4. (text/plain)

    Number of further generation to add to ensure sufficient power:331800

Log ((list of depth 1))

  1. (application/octet-stream)

    Sorry but we cannot show this type of content in the browser. Please download it to view it on your local machine.

  2. (application/octet-stream)

    Sorry but we cannot show this type of content in the browser. Please download it to view it on your local machine.

  3. (application/octet-stream)

    Sorry but we cannot show this type of content in the browser. Please download it to view it on your local machine.

  4. (text/plain)

    Application:MrBayes_16CPUs
    JobID:569984
    StdError:

Inputs

Data (2)

MSA_fasta help

>ABY27676/1-453 ABY27676
------------------------------------------------------------------------
------------------------------------------------------------------------
------------------------------------------------------------TTAATATTAGGA
GCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTA
ATAATTTCTTCAATAGTGGAGATAGGGGTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTA
GGTCATTCAGGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGA
GCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTT
GTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTACCAGTTTTAGCCTGGGGTATTACGATA
TTATTAACAGATCGAAATTTTAACACTTCTTTTTTTGACCCTGCGGGTGGAGGTGATCCAATTTTATTTCAA
CATCTTTTT
>ADW61587/1-657 ADW61587
ACGTTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATTGAA
TTAGGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTT
ATAATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGC
GCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTA
ATTATTTCTTCTATAGTAGAAATGGGAGTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCTAGTTTAGAG
GGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGG
GCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTT
GTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTCCAGTATTGGCGGGGGCTATCACAATA
TTATTAACTGATCGAAATTTTAATACTTCGTTTTTTGACCCTTCAGGAGGGGGGGATCCAATCCTTTTCCAA
CATTTATTT
>AEE92862/1-657 AEE92862
ACGTTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGGAGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTACCAGTATTGGCGGGGGCTATTACGATA
TTACTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAG
CATTTATTT
>AEC60810/1-657 AEC60810
ACTTTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGAA
TTAGGTCAAGTTGGAAGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTT
ATGATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGT
GCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTA
TTATTATCTTCTTTAACAGATGTAGGGGTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCCTCTGGGGTT
GGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGG
GCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTT
GTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTACCTGTATTGGCTGGTGCTATTACTATA
TTGTTGACTGATCGAAATTTCAATACTTCTTTTTTTGATCCTGCTGGAGGTGGTGATCCTATTTTGTTTCAA
CATTTATTT
>AEE92861/1-633 AEE92861
------------------------TGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGAATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGCCAGTATTGGCGGGGGCTATTACAATA
TTATTGACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAA
CATTTATTT
>AEE92860/1-648 AEE92860
---------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGAAGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGCCAGTATTGGCGGGGGCTATTACAATA
TTATTGACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAA
CATTTATTT
>ADD09384/1-555 ADD09384
------------------------------------------------------------------------
------------------------------TATCAGCTATACAATGTATTAATTACCGCTCATGCTATAATT
ATGGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGT
GCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTA
ATGCTGTCAGGTTTGGTTGATGGAGGAGCTGGTACTGGCTGGACACTGTATCCTCCTCTAAGTAGTATAGTA
GGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGT
TCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTT
GTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTCCTGTGTTAGGGGGTGCAATAACCATG
TTACTGACTGATCGAAATTTTGGTACTACTTTTTTCAAGCCTGATGGTGGCGGAGATCCAGTGTTATTTCAG
CATTTATTT
>ADJ82639/1-645 ADJ82639
ACTTTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATGGAA
TTAGGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTA
ATAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGA
GCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTA
TCTATATCTTCTATAGTAGAAATAGGAGTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCGTCTACAGTT
GGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGA
GCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTT
GTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTACCTGTTTTAGCAGGTGCTATTACTATA
TTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCTGGGGGAGGAGATCCTAATTTATTT---
---------
>ADQ21240/1-648 ADQ21240
AGATTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGAG
TTGGGACAAACTGGTAGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTA
ATAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGA
GCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTG
TTTATTTCAAGCATAGATGAGATAGGAGTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCCTCTTTAGAG
GGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGG
GCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTT
GTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTCCTGTGTTAGCTGGGGCTATCACAATA
TTACTGACGGATCGTAATTTTAATACTTCATTTTTTGATCCTTGTGGGGGGGGGGATCCTGTTTTGTTTCAA
---------
>AEE92882/1-657 AEE92882
ACGTTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGGAGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTACCAGTATTGGCGGGGGCTATTACGATA
TTACTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAG
CATTTATTT
>ADW58691/1-657 ADW58691
ACTTTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATAGAA
TTAGGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTT
ATAATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGT
GCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTA
TTTATTTCTTCTATAGTTGAAATAGGAGTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCATCTAGTGTA
GGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGA
GCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTT
GTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTACCTGTTTTAGCAGGTGCTATTACTATA
TTATTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATTTCAA
CATTTATTT
>ADW58631/1-657 ADW58631
ACTTTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATAGAA
TTAGGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTT
ATAATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGT
GCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTA
TTTATTTCTTCTATAGCTGAAATAGGAGTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCATCTAGTGTA
GGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGA
GCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTT
GTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTACCTGTTTTAGCAGGTGCTATTACTATA
TTATTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATTTCAA
CATTTATTT
>ACM89220/1-657 ACM89220
ACTTTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGAA
CTAGGATTTTCTGGAAGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATT
ATAATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGA
GCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTA
TTTATTTCTTCTATGGTTGAAATCGGAGTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCTTCTTCTGTG
GGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGT
GCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTT
GTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTACCAGTATTAGCTGGGGCTATTACTATA
CTTTTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCTGGGGGTGGGGATCCAATTTTATTTCAG
CATTTATTT
>AEE92867/1-642 AEE92867
---------------TTTGGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGAAGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGCCAGTATTGGCGGGGGCTATTACAATA
TTATTGACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAA
CATTTATTT
>ADH12119/1-645 ADH12119
ACTTTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGAG
TTGGGGCAATCTGGTAGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTT
ATAATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGG
GCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTA
TTTATTTCTTCTATGGTGGAAATAGGGGTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCGTCTCTAGAA
GGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGG
GCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTT
GTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTCCGGTTTTAGCTGGGGCTATCACTATG
TTATTAACTGATCGAAATTTTAATACATCGTTTTTTGATCCTTCGGGGGGAGGGGATCCTATTTTTTTT---
---------

Possible_Partition help

Gene1_pos1 = 1-657\3;
Gene1_pos2 = 2-657\3;
Gene1_pos3 = 3-657\3;

Parameters (6)

File_name help

pippo

Linking_branches help

linked

Number_of_MCMCMC_generations help

100000

Number_of_runs help

2

SampleSize help

100

Statistical_Criterium help

AIC

Advanced
Eu_logo
BioVeL has received funding from the European Union's Seventh Framework Programme for research, technological development and demonstration under grant agreement no. 283359.

Portal version: 1.6.1-61c993b