14-200x200

Bayesian Phylogenetic Inference: Select Model For Me - Submission (v2) run 27 Jul 2015 08:27:44 UTC


Name:

Workflow: Bayesian Phylogenetic Inference: Select Model For Me - Submission

Category: Phylogenetics

Status: Finished

Created at: 27 Jul 2015 08:27:52 UTC

Started at: 27 Jul 2015 08:27:54 UTC

Finished at: 27 Jul 2015 08:33:24 UTC

Outputs

Results (3)

JobID help (text/plain)

570042

NameFile (text/plain)

pippo

Errors/Logs (3)

Log ((list of depth 1))

  1. (text/plain)

    Application:PartitionFinder
    JobID:570041
    StdError:http://testjst.ba.infn.it/openacces/1373459336/test.phy http://testjst.ba.infn.it/openacces/1373459336/partition_finder.cfg
    --2015-07-27 10:27:55--  http://testjst.ba.infn.it/software//PartitionFinder.tar.gz
    Resolving testjst.ba.infn.it... 90.147.66.2
    Connecting to testjst.ba.infn.it|90.147.66.2|:80... connected.
    HTTP request sent, awaiting response... 200 OK
    Length: 698976 (683K) [application/x-gzip]
    Saving to: ���PartitionFinder.tar.gz���
    
         0K .......... .......... .......... .......... ..........  7% 24.2M 0s
        50K .......... .......... .......... .......... .......... 14% 25.8M 0s
       100K .......... .......... .......... .......... .......... 21% 26.6M 0s
       150K .......... .......... .......... .......... .......... 29% 28.7M 0s
       200K .......... .......... .......... .......... .......... 36% 26.8M 0s
       250K .......... .......... .......... .......... .......... 43% 27.5M 0s
       300K .......... .......... .......... .......... .......... 51% 29.4M 0s
       350K .......... .......... .......... .......... .......... 58% 27.4M 0s
       400K .......... .......... .......... .......... .......... 65% 21.5M 0s
       450K .......... .......... .......... .......... .......... 73% 28.6M 0s
       500K .......... .......... .......... .......... .......... 80% 28.5M 0s
       550K .......... .......... .......... .......... .......... 87% 27.3M 0s
       600K .......... .......... .......... .......... .......... 95% 32.3M 0s
       650K .......... .......... .......... ..                   100% 30.4M=0.02s
    
    2015-07-27 10:27:55 (27.2 MB/s) - ���PartitionFinder.tar.gz��� saved [698976/698976]
    
    partfinder/
    partfinder/__init__.py
    partfinder/__init__.pyc
    partfinder/algorithm.py
    partfinder/algorithm.pyc
    partfinder/alignment.py
    partfinder/alignment.pyc
    partfinder/analysis.py
    partfinder/analysis.pyc
    partfinder/analysis_method.py
    partfinder/analysis_method.pyc
    partfinder/config.py
    partfinder/config.pyc
    partfinder/main.py
    partfinder/main.pyc
    partfinder/parser.py
    partfinder/parser.pyc
    partfinder/partition.py
    partfinder/partition.pyc
    partfinder/phyml.py
    partfinder/phyml.pyc
    partfinder/phyml_models.py
    partfinder/phyml_models.pyc
    partfinder/pyparsing.py
    partfinder/pyparsing.pyc
    partfinder/reporter.py
    partfinder/reporter.pyc
    partfinder/results.py
    partfinder/results.pyc
    partfinder/scheme.py
    partfinder/scheme.pyc
    partfinder/submodels.py
    partfinder/submodels.pyc
    partfinder/subset.py
    partfinder/subset.pyc
    partfinder/threadpool.py
    partfinder/threadpool.pyc
    partfinder/util.py
    partfinder/util.pyc
    PartitionFinderProtein.py
    PartitionFinder.py
    programs/
    programs/phyml
    README.txt
    non �� posizionale
    test.phy
    partition_finder.cfg
    --2015-07-27 10:27:55--  http://testjst.ba.infn.it/openacces/1373459336/test.phy
    Resolving testjst.ba.infn.it... 90.147.66.2
    Connecting to testjst.ba.infn.it|90.147.66.2|:80... connected.
    HTTP request sent, awaiting response... 200 OK
    Length: 10282 (10K) [text/plain]
    Saving to: ���test.phy���
    
         0K ..........                                            100%  141M=0s
    
    2015-07-27 10:27:55 (141 MB/s) - ���test.phy��� saved [10282/10282]
    
    --2015-07-27 10:27:55--  http://testjst.ba.infn.it/openacces/1373459336/partition_finder.cfg
    Resolving testjst.ba.infn.it... 90.147.66.2
    Connecting to testjst.ba.infn.it|90.147.66.2|:80... connected.
    HTTP request sent, awaiting response... 200 OK
    Length: 197 [text/plain]
    Saving to: ���partition_finder.cfg���
    
         0K                                                       100% 5.88M=0s
    
    2015-07-27 10:27:55 (5.88 MB/s) - ���partition_finder.cfg��� saved [197/197]
    
    
    start execution
    INFO     | 2015-07-27 10:27:56,508 | You appear to have 64 cpus
    INFO     | 2015-07-27 10:27:56,512 | ------------- PartitionFinder v1.0.1 -----------------
    INFO     | 2015-07-27 10:27:56,516 | You have Python version 2.7
    INFO     | 2015-07-27 10:27:56,516 | Setting datatype to 'DNA'
    INFO     | 2015-07-27 10:27:56,518 | Setting working folder to: '/home/donvito/execute_task_force/1796631514/Folder'
    INFO     | 2015-07-27 10:27:56,519 | ------------------------ BEGINNING NEW RUN -------------------------------
    INFO     | 2015-07-27 10:27:56,520 | Loading configuration at './partition_finder.cfg'
    INFO     | 2015-07-27 10:27:56,571 | Setting 'alignment' to 'test.phy'
    INFO     | 2015-07-27 10:27:56,573 | Setting 'branchlengths' to 'linked'
    INFO     | 2015-07-27 10:27:56,576 | Setting 'models' to 'mrbayes'
    INFO     | 2015-07-27 10:27:56,577 | Setting datatype to 'DNA'
    INFO     | 2015-07-27 10:27:56,578 | Setting 'model_selection' to 'aic'
    INFO     | 2015-07-27 10:27:56,593 | Setting 'search' to 'greedy'
    INFO     | 2015-07-27 10:27:56,596 | Looking for alignment file './test.phy'...
    INFO     | 2015-07-27 10:27:56,596 | Beginning Analysis
    INFO     | 2015-07-27 10:27:56,597 | Removing Schemes in './analysis/schemes' (they will be recalculated from existing subset data)
    INFO     | 2015-07-27 10:27:56,602 | Reading alignment file './test.phy'
    INFO     | 2015-07-27 10:27:56,633 | Making BioNJ tree for ./analysis/start_tree/filtered_source.phy
    INFO     | 2015-07-27 10:27:56,777 | Estimating GTR+I+G branch lengths on tree
    INFO     | 2015-07-27 10:28:56,387 | Branchlength estimation finished
    INFO     | 2015-07-27 10:28:56,389 | Starting tree with branch lengths is here: ./analysis/start_tree/filtered_source.phy_phyml_tree.txt
    INFO     | 2015-07-27 10:28:56,390 | Performing greedy analysis
    INFO     | 2015-07-27 10:28:56,391 | This will result in a maximum of 5 schemes being created
    INFO     | 2015-07-27 10:28:56,392 | PartitionFinder will have to analyse a maximum of 7 subsets of sites to complete this analysis
    INFO     | 2015-07-27 10:28:56,394 | Analysing starting scheme (scheme 1)
    INFO     | 2015-07-27 10:28:56,394 | Analysing scheme 1/5
    INFO     | 2015-07-27 10:28:56,396 | Analysing subset 1/7: 14.29% done
    INFO     | 2015-07-27 10:29:14,101 | Analysing subset 2/7: 28.57% done
    INFO     | 2015-07-27 10:29:34,336 | Analysing subset 3/7: 42.86% done
    INFO     | 2015-07-27 10:30:08,004 | ***Greedy algorithm step 1***
    INFO     | 2015-07-27 10:30:08,006 | Analysing scheme 1/3
    INFO     | 2015-07-27 10:30:08,007 | Analysing subset 4/7: 57.14% done
    INFO     | 2015-07-27 10:30:48,915 | Analysing scheme 2/3
    INFO     | 2015-07-27 10:30:48,916 | Analysing subset 5/7: 71.43% done
    INFO     | 2015-07-27 10:31:19,825 | Analysing scheme 3/3
    INFO     | 2015-07-27 10:31:19,827 | Analysing subset 6/7: 85.71% done
    INFO     | 2015-07-27 10:31:58,091 | Greedy algorithm finished after 1 steps
    INFO     | 2015-07-27 10:31:58,092 | Highest scoring scheme is scheme 1, with aic score of 7267.035
    INFO     | 2015-07-27 10:31:58,094 | Information on best schemes is here: ./analysis/best_schemes.txt
    INFO     | 2015-07-27 10:31:58,095 | Information on all schemes analysed is here: ./analysis/all_schemes.txt
    INFO     | 2015-07-27 10:31:58,096 | Processing complete.
    end execution
    RaxML-style partition definitions
    

PartitionFinderOutput help (text/plain)

Best scheme according to Greedy algorithm, analysed with aic

Scheme Name    : 1
Scheme lnL     : -3580.51738
Scheme AIC     : 7267.03476
Scheme AICc    : 7276.52729731
Scheme BIC     : 7504.88201298
Num params     : 53
Num sites      : 657
Num subsets    : 3

Subset | Best Model | Subset Partitions              | Subset Sites                   | Alignment                               
1      | GTR+I+G    | Gene1_pos1                     | 1-657\3                        | ./analysis/phyml/50bf1643d2a386419c9264eccd173b6b.phy
2      | GTR+G      | Gene1_pos2                     | 2-657\3                        | ./analysis/phyml/70bf411485fb1fe3503bc4f094e24b4a.phy
3      | HKY+G      | Gene1_pos3                     | 3-657\3                        | ./analysis/phyml/2d8c90733ab81be78313d5cf934c6639.phy


Scheme Description in PartitionFinder format
Scheme_1 = (Gene1_pos1) (Gene1_pos2) (Gene1_pos3);

RaxML-style partition definitions
DNA, p1 = 1-657\3
DNA, p2 = 2-657\3
DNA, p3 = 3-657\3



SessionID (text/plain)

1373459336

Inputs

Data (2)

MSA_fasta help (text/plain)

>ABY27676/1-453 ABY27676
------------------------------------------------------------------------
------------------------------------------------------------------------
------------------------------------------------------------TTAATATTAGGA
GCTCCAGATATAGCTTTTCCTCGAATAAATAATCTTAGTTTTTGGTTGCTTCCTCCTTCTTTGATTTTATTA
ATAATTTCTTCAATAGTGGAGATAGGGGTTGGGGCGGGGTGAACTATTTATCCTCCTTTATCGGGTAGTCTA
GGTCATTCAGGGGTTTCAGTAGATTTAGCTATTTTTAGCTTACATTTGGCGGGAGCTTCTTCAATTATAGGA
GCAATTAATTTTATTTCCACTATTTTAAATATACGTTCAGTTGGGATATCTATAGATAAGGTACCTTTATTT
GTGTGATCTGTATTAGTTACTGCTGTTTTATTATTATTATCTTTACCAGTTTTAGCCTGGGGTATTACGATA
TTATTAACAGATCGAAATTTTAACACTTCTTTTTTTGACCCTGCGGGTGGAGGTGATCCAATTTTATTTCAA
CATCTTTTT
>ADW61587/1-657 ADW61587
ACGTTATATTTAATATTTGGGGCTTGAGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATTGAA
TTAGGTCAACCTGGGAGGTTTATTGGGGATGATCAATTATATAATGTAATCGTTACTGCTCATGCATTTGTT
ATAATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGC
GCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGCTACTCCCTCCTTCATTATTTTTATTA
ATTATTTCTTCTATAGTAGAAATGGGAGTGGGGGCAGGATGGACGGTTTATCCTCCTTTAGCTAGTTTAGAG
GGCCATGCTGGCAGGTCAGTGGATTTTGCTATTTTTTCTTTACATTTAGCGGGGGCCTCCTCTATTATGGGG
GCTATTAATTTTATTTCTACTATTATTAATATACGATCGCATGGAATAACTATAGAAAAAGTACCTTTATTT
GTATGATCAGTATTGATTACTGCTGTATTATTATTATTATCACTTCCAGTATTGGCGGGGGCTATCACAATA
TTATTAACTGATCGAAATTTTAATACTTCGTTTTTTGACCCTTCAGGAGGGGGGGATCCAATCCTTTTCCAA
CATTTATTT
>AEE92862/1-657 AEE92862
ACGTTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGGAGATTGTTGGGTGATGATCATATATATAATGTTATGGTAACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTACCAGTATTGGCGGGGGCTATTACGATA
TTACTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAG
CATTTATTT
>AEC60810/1-657 AEC60810
ACTTTGTATTTATTGTTTGGTATTTGATCTGCTATAATGGGAACGGCAATAAGAGTGATTATTCGAATTGAA
TTAGGTCAAGTTGGAAGATTGTTGGGTGATGATCATTTATATAATGTAATTGTAACAGCACATGCTTTGGTT
ATGATTTTTTTTATAGTTATACCGATTTTGATTGGTGGATTTGGAAATTGAATAGTTCCTTTGATGTTAGGT
GCTCCAGATATAGCATTCCCACGTATAAATAATTTGAGATTTTGATTGCTTCCTCCATCATTATTTTTGTTA
TTATTATCTTCTTTAACAGATGTAGGGGTTGGAGCCGGGTGAACTATTTATCCTCCTTTATCCTCTGGGGTT
GGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGG
GCGATTAATTTTATTACAACAATTATTAATATGCGAAGATTTGGAATAACAATAGAACGTGTACCTTTATTT
GTGTGATCAGTTCTTATTACTACTATTTTATTATTGCTTTCTTTACCTGTATTGGCTGGTGCTATTACTATA
TTGTTGACTGATCGAAATTTCAATACTTCTTTTTTTGATCCTGCTGGAGGTGGTGATCCTATTTTGTTTCAA
CATTTATTT
>AEE92861/1-633 AEE92861
------------------------TGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGAATATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGCCAGTATTGGCGGGGGCTATTACAATA
TTATTGACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAA
CATTTATTT
>AEE92860/1-648 AEE92860
---------TTTGTTTTTGGAGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGAAGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGCCAGTATTGGCGGGGGCTATTACAATA
TTATTGACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAA
CATTTATTT
>ADD09384/1-555 ADD09384
------------------------------------------------------------------------
------------------------------TATCAGCTATACAATGTATTAATTACCGCTCATGCTATAATT
ATGGTATTTTTCATGATTATGCCAGCTTTATTTGGTGGATTTGGTAATTACTTTGTACCAATTTTAATAGGT
GCCCCGGATATGGCTTTTCCTAGGCTAAATAATATAAGTTTTTGGCTACTTGTCCCTGCTTTTATATTATTA
ATGCTGTCAGGTTTGGTTGATGGAGGAGCTGGTACTGGCTGGACACTGTATCCTCCTCTAAGTAGTATAGTA
GGGCATCCTGGCGCTGCTGTCGATATGGCTATTTTAAGCTTACATCTTACAGGGCTTTCCTCCATTCTTGGT
TCAATTAATATGATTGTCACTATCTTTAATATGAGAACTGATGGTATGGGGTTATTTGAAATGCCCTTATTT
GTTTGGTCAATTTTGGTTACTGCCTTCTTGCTGATACTAGCAATTCCTGTGTTAGGGGGTGCAATAACCATG
TTACTGACTGATCGAAATTTTGGTACTACTTTTTTCAAGCCTGATGGTGGCGGAGATCCAGTGTTATTTCAG
CATTTATTT
>ADJ82639/1-645 ADJ82639
ACTTTATATTTAATGTTTGGGGTTTGGTCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATGGAA
TTAGGGAATCCTGGTAGATTGTTAGGTGATGATCATTTGTATAATGTTATAGTTACTGCTCATGCTTTTGTA
ATAATTTTTTTTATAGTAATGCCTATTCTTATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGA
GCTCCAGATATATCATTTCCTCGAATAAATAATCTTTCTTTTTGATTATTACCTCCTTCTTTATTTTTGTTA
TCTATATCTTCTATAGTAGAAATAGGAGTTGGGGCTGGGTGAACTGTTTATCCTCCTTTAGCGTCTACAGTT
GGGCACATAGGAAATTCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCTGGAGCTTCTTCTATTATAGGA
GCTGTAAATTTTATTTCTACCATTATTAATATACGAATATTAGGAATATCTATAGAGAAGGTTCCTCTTTTT
GTTTGATCAGTTTTAATTACAGCAGTATTATTATTACTTTCTTTACCTGTTTTAGCAGGTGCTATTACTATA
TTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCTGGGGGAGGAGATCCTAATTTATTT---
---------
>ADQ21240/1-648 ADQ21240
AGATTATATTTTGTTTTTGGGGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGTGTTGAG
TTGGGACAAACTGGTAGTTTGTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTGTA
ATAATTTTTTTTATAGTTATGCCTATTTTAATTGGGGGTTTTGGAAATTGGCTGATTCCACTAATACTAGGA
GCTCCGGATATAGCTTTCCCTCGTATAAATAATTTGAGATTTTGGCTTTTACCCCCTTCTTTATTATTACTG
TTTATTTCAAGCATAGATGAGATAGGAGTGGGGGCGGGATGAACGGTTTACCCCCCTCTTGCCTCTTTAGAG
GGACATTCTGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACACTTAGCTGGAGCGTCTTCTATTATAGGG
GCTATTAATTTTATTTCCACAATTTTGAATATACGGGGTTATGGAATATCTATAGAAAAAGTACCTTTATTT
GTTTGGTCCGTGTTAATTACAGCTGTATTATTATTGTTATCTCTTCCTGTGTTAGCTGGGGCTATCACAATA
TTACTGACGGATCGTAATTTTAATACTTCATTTTTTGATCCTTGTGGGGGGGGGGATCCTGTTTTGTTTCAA
---------
>AEE92882/1-657 AEE92882
ACGTTATATTTTGTTTTTGGAGCTTGATCTGCTATGGTAGGGACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGGAGATTGTTGGGTGATGATCATATATATAATGTTATTGTAACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTACTGCCTTTAATAGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCACCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACCACTATTATTAATATGCGTACAAATGGTATAACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTATTGTCTTTACCAGTATTGGCGGGGGCTATTACGATA
TTACTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAG
CATTTATTT
>ADW58691/1-657 ADW58691
ACTTTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATAGAA
TTAGGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTT
ATAATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGT
GCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTATTTTTATTA
TTTATTTCTTCTATAGTTGAAATAGGAGTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCATCTAGTGTA
GGTCATATGGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGA
GCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTT
GTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTACCTGTTTTAGCAGGTGCTATTACTATA
TTATTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATTTCAA
CATTTATTT
>ADW58631/1-657 ADW58631
ACTTTATATTTAATATTTGGAGCTTGATCTGCTATAGTAGGGACTGCTATAAGAGTGTTAATTCGAATAGAA
TTAGGTCAATCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTTGTAGTTACTGCACATGCTTTTGTT
ATAATTTTTTTTATAGTTATACCTATTTTGATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGT
GCTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGTTTTTGATTACTACCTCCTTCTTTATTTTTATTA
TTTATTTCTTCTATAGCTGAAATAGGAGTTGGAGCAGGATGAACAGTTTATCCTCCATTGGCATCTAGTGTA
GGTCATATAGGAAGTGCAATAGATTTTGCTATTTTTTCATTACATTTGGCTGGTGCTTCTTCTATTATAGGA
GCAGTAAATTTTATTACTACTATTATTAATATACGTTCTCATGGAATAAGAATAGAAAAAGTTCCTTTATTT
GTTTGATCAGTTTTAATTACAGCTATTTTGTTGTTATTATCTTTACCTGTTTTAGCAGGTGCTATTACTATA
TTATTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATTTCAA
CATTTATTT
>ACM89220/1-657 ACM89220
ACTTTATATTTTTTATTTGGTACTTGATCAGCAATAATTGGTACAGCAATAAGTGTTTTAATTCGTGTTGAA
CTAGGATTTTCTGGAAGATTTTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCTCATGCTTTTATT
ATAATTTTTTTTATAGTTATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAAGA
GCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGATTTTGGTTACTACCTCCTTCGTTATTATTGTTA
TTTATTTCTTCTATGGTTGAAATCGGAGTTGGAGCAGGGTGGACTATTTATCCTCCTTTATCTTCTTCTGTG
GGTCATTCTGGTGCATCTATGGATTTTGCAATTTTTTCTCTTCATTTAGCTGGTGCTTCTTCTATTATAGGT
GCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATGGTATAAGAATAGAAAAGATTCCTTTATTT
GTATGATCTGTATTAATTACAGCTGTCTTATTATTATTATCATTACCAGTATTAGCTGGGGCTATTACTATA
CTTTTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCTGGGGGTGGGGATCCAATTTTATTTCAG
CATTTATTT
>AEE92867/1-642 AEE92867
---------------TTTGGGGCTTGATCTGCTATGGTAGGTACCGGAATAAGAGTAATTATTCGGTCTGAG
TTGGGGCAAGTGGGAAGATTATTAGGTGATGATCATATATATAATGTTATGGTTACTGCTCATGCTTTAGTA
ATGATTTTTTTTATGGTAATGCCAATCATGATTGGAGGTTTTGGTAATTGATTATTGCCTTTAATGGTAGGA
GCTCCTGATATGGCTTTTCCTCGTATAAATAATTTGAGTTTTTGATTGCTTCCTCCTTCTTTATTTTTGTTG
GTGTTGTCTTCTTTAACAGATGTTGGGGTAGGGGCTGGTTGAACTATTTATCCTCCTTTGTCTTCGGGAGTT
GGGCATGGAGGTGGGGGTATGGATTTTGCTATTTTTTCTTTGCATTTAGCTGGGGCTTCTTCTATTATGGGG
GCGATTAATTTTATTACTACTATTATTAATATGCGTACAAATGGTATGACTATGGAGCGTGTGCCGTTGTTT
GTGTGATCAGTATTAGTGACTGCTATTTTGTTATTGTTGTCTTTGCCAGTATTGGCGGGGGCTATTACAATA
TTATTGACAGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTGTTCTGTTTCAA
CATTTATTT
>ADH12119/1-645 ADH12119
ACTTTATACTTGGTTTTTGGTGCTTGAGCGGCTATGGTTGGAACTGCAATAAGTGTTTTAATTCGAATTGAG
TTGGGGCAATCTGGTAGATTTATGGGAGATGATCAGTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTT
ATAATTTTTTTTATGGTTATGCCTATTTTGATTGGGGGCTTTGGTAATTGACTGGTTCCTTTGATGTTGGGG
GCTCCTGATATGGCTTTTCCTCGCATGAATAATTTAAGGTTTTGATTATTGCCTCCTTCTTTATTTTTATTA
TTTATTTCTTCTATGGTGGAAATAGGGGTTGGGGCTGGTTGAACGATCTACCCTCCTTTAGCGTCTCTAGAA
GGACATTCAGGAAGTTCGGTTGATTTTGCCATTTTTTCTTTGCATTTGGCTGGGGCCTCTTCTATTATAGGG
GCTATTAATTTTATTTCTACAATTTTGAATATACGGTCTTATGGGATGTCTATGGAAAAAGTTCCTTTGTTT
GTTTGGTCGGTTTTAATTACTGCTGTTTTGCTCCTATTATCACTTCCGGTTTTAGCTGGGGCTATCACTATG
TTATTAACTGATCGAAATTTTAATACATCGTTTTTTGATCCTTCGGGGGGAGGGGATCCTATTTTTTTT---
---------

Possible_Partition help (text/plain)

Gene1_pos1 = 1-657\3;
Gene1_pos2 = 2-657\3;
Gene1_pos3 = 3-657\3;

Parameters (7)

Email (text/plain)

File_name help (text/plain)

pippo

Linking_branches help (text/plain)

linked

Number_of_MCMCMC_generations help (text/plain)

100000

Number_of_runs help (text/plain)

2

SampleSize help (text/plain)

100

Statistical_Criterium help (text/plain)

AIC

Advanced
Eu_logo
BioVeL has received funding from the European Union's Seventh Framework Programme for research, technological development and demonstration under grant agreement no. 283359.

Portal version: 1.6.1-61c993b